Review



grna oligonucleotides  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs grna oligonucleotides
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Grna Oligonucleotides, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1641 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/BsmBI-v2/bio_rxiv__64898__2026__03__31__715508-202-15-33
    Average 99 stars, based on 1641 article reviews
    grna oligonucleotides - by Bioz Stars, 2026-09
    99/100 stars

    Images

    1) Product Images from "DNA Damage Response Proteins Are Involved in the Formation of Defective HIV-1 Proviruses"

    Article Title: DNA Damage Response Proteins Are Involved in the Formation of Defective HIV-1 Proviruses

    Journal: bioRxiv

    doi: 10.64898/2026.03.31.715508

    A) Flow cytometry gating strategy for K562 VPR cells transduced with CRISPRa-gRNA and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Figure Legend Snippet: A) Flow cytometry gating strategy for K562 VPR cells transduced with CRISPRa-gRNA and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.

    Techniques Used: Flow Cytometry, Transduction, Control, Transfection

    Related Articles

    Hybridization:

    Article Title: Automated, self-resistance gene-guided, and high-throughput genome mining of bioactive natural products from Streptomyces
    Article Snippet: .. The procedures included four steps as follows: 1) Hybridization of gRNA oligonucleotides: 12 μL of master mix containing 2 μL of 10 × NEBuffer 3.1 were aliquoted into 96-well PCR plates using FCA for sample preparation. ..

    Polymerase Chain Reaction:

    Article Title: Automated, self-resistance gene-guided, and high-throughput genome mining of bioactive natural products from Streptomyces
    Article Snippet: .. The procedures included four steps as follows: 1) Hybridization of gRNA oligonucleotides: 12 μL of master mix containing 2 μL of 10 × NEBuffer 3.1 were aliquoted into 96-well PCR plates using FCA for sample preparation. ..

    Sample Prep:

    Article Title: Automated, self-resistance gene-guided, and high-throughput genome mining of bioactive natural products from Streptomyces
    Article Snippet: .. The procedures included four steps as follows: 1) Hybridization of gRNA oligonucleotides: 12 μL of master mix containing 2 μL of 10 × NEBuffer 3.1 were aliquoted into 96-well PCR plates using FCA for sample preparation. ..

    Cloning:

    Article Title: TROP2 translation mediated by dual m 6 A/m 7 G RNA modifications promotes bladder cancer development.
    Article Snippet: RNA modifications, including adenine methylation (m6A) of mRNA and guanine methylation (m7G) of tRNA, are crucial for the biological function of RNA.. However, the mechanism underlying the translation of specific genes synergistically mediated by dual m6A/m7G RNA modifications in bladder cancer (BCa) remains unclear.. We demonstrated that m6A methyltransferase METTL3-mediated programmable m6A modification of oncogene trophoblast cell surface protein 2 (TROP2) mRNA promoted its translation during malignant transformation of bladder epithelial cells. m7G methyltransferase METTL1 enhanced TROP2 translation by mediating m7G modification of certain tRNAs.

    Synthesized:

    Article Title: TROP2 translation mediated by dual m 6 A/m 7 G RNA modifications promotes bladder cancer development.
    Article Snippet: RNA modifications, including adenine methylation (m6A) of mRNA and guanine methylation (m7G) of tRNA, are crucial for the biological function of RNA.. However, the mechanism underlying the translation of specific genes synergistically mediated by dual m6A/m7G RNA modifications in bladder cancer (BCa) remains unclear.. We demonstrated that m6A methyltransferase METTL3-mediated programmable m6A modification of oncogene trophoblast cell surface protein 2 (TROP2) mRNA promoted its translation during malignant transformation of bladder epithelial cells. m7G methyltransferase METTL1 enhanced TROP2 translation by mediating m7G modification of certain tRNAs.

    Clone Assay:

    Article Title: TROP2 translation mediated by dual m 6 A/m 7 G RNA modifications promotes bladder cancer development.
    Article Snippet: RNA modifications, including adenine methylation (m6A) of mRNA and guanine methylation (m7G) of tRNA, are crucial for the biological function of RNA.. However, the mechanism underlying the translation of specific genes synergistically mediated by dual m6A/m7G RNA modifications in bladder cancer (BCa) remains unclear.. We demonstrated that m6A methyltransferase METTL3-mediated programmable m6A modification of oncogene trophoblast cell surface protein 2 (TROP2) mRNA promoted its translation during malignant transformation of bladder epithelial cells. m7G methyltransferase METTL1 enhanced TROP2 translation by mediating m7G modification of certain tRNAs.

    Article Title: Atrial fibrillation variant-to-gene prioritization through cross-ancestry eQTL and single-nucleus multiomic analyses.
    Article Snippet: .. The above gRNA oligonucleotides were annealed at a final concentration of 0.4uM and were cloned into 500ng of Esp3I-digested LentiGuide-Puro plasmid using T4 DNA Ligase (Catalog #M0202, NEB). .. Ligated plasmids were transformed into OneShot Stbl3 E. coli competent cells (Catalog #C737303, Invitrogen) as per the manufacturer’s protocol.

    Expressing:

    Article Title: TROP2 translation mediated by dual m 6 A/m 7 G RNA modifications promotes bladder cancer development.
    Article Snippet: RNA modifications, including adenine methylation (m6A) of mRNA and guanine methylation (m7G) of tRNA, are crucial for the biological function of RNA.. However, the mechanism underlying the translation of specific genes synergistically mediated by dual m6A/m7G RNA modifications in bladder cancer (BCa) remains unclear.. We demonstrated that m6A methyltransferase METTL3-mediated programmable m6A modification of oncogene trophoblast cell surface protein 2 (TROP2) mRNA promoted its translation during malignant transformation of bladder epithelial cells. m7G methyltransferase METTL1 enhanced TROP2 translation by mediating m7G modification of certain tRNAs.

    Plasmid Preparation:

    Article Title: TROP2 translation mediated by dual m 6 A/m 7 G RNA modifications promotes bladder cancer development.
    Article Snippet: RNA modifications, including adenine methylation (m6A) of mRNA and guanine methylation (m7G) of tRNA, are crucial for the biological function of RNA.. However, the mechanism underlying the translation of specific genes synergistically mediated by dual m6A/m7G RNA modifications in bladder cancer (BCa) remains unclear.. We demonstrated that m6A methyltransferase METTL3-mediated programmable m6A modification of oncogene trophoblast cell surface protein 2 (TROP2) mRNA promoted its translation during malignant transformation of bladder epithelial cells. m7G methyltransferase METTL1 enhanced TROP2 translation by mediating m7G modification of certain tRNAs.

    Article Title: Atrial fibrillation variant-to-gene prioritization through cross-ancestry eQTL and single-nucleus multiomic analyses.
    Article Snippet: .. The above gRNA oligonucleotides were annealed at a final concentration of 0.4uM and were cloned into 500ng of Esp3I-digested LentiGuide-Puro plasmid using T4 DNA Ligase (Catalog #M0202, NEB). .. Ligated plasmids were transformed into OneShot Stbl3 E. coli competent cells (Catalog #C737303, Invitrogen) as per the manufacturer’s protocol.

    Article Title: DNA Damage Response Proteins Are Involved in the Formation of Defective HIV-1 Proviruses
    Article Snippet: Single gRNAs were cloned into LentiGuide-Puro-P2A-EGFP following the Zhang lab SAM cloning protocol provided by Addgene (Zhang lab SAM cloning protocol, Addgene, ( )), with minor modifications to reagent sources and vector backbone. .. The Golden Gate reaction contained 25 ng backbone plasmid, 1 μl of 1:10 diluted annealed gRNA oligonucleotides, 0.5 μl BsmBI-v2, 0.5 μl T4 DNA ligase (Thermo Scientific, EL0011), 1 μl 10 mM ATP (New England Biolabs, P0756S), 1 μl NEB Buffer r3.1 (New England Biolabs), and nuclease-free water to the final reaction volume. .. A volume of 1 μl of the Golden Gate reaction was transformed into Stellar Competent Cells (TaKaRa Bio, 636766) according to the manufacturer’s Stellar Competent Cells protocol (PT5055-2).

    Concentration Assay:

    Article Title: Atrial fibrillation variant-to-gene prioritization through cross-ancestry eQTL and single-nucleus multiomic analyses.
    Article Snippet: .. The above gRNA oligonucleotides were annealed at a final concentration of 0.4uM and were cloned into 500ng of Esp3I-digested LentiGuide-Puro plasmid using T4 DNA Ligase (Catalog #M0202, NEB). .. Ligated plasmids were transformed into OneShot Stbl3 E. coli competent cells (Catalog #C737303, Invitrogen) as per the manufacturer’s protocol.



    Similar Products

    96
    ATCC 4941 oligonucleotides grna mouse igf1r caccgctatggtggagaggtaacag
    4941 Oligonucleotides Grna Mouse Igf1r Caccgctatggtggagaggtaacag, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/Saccharomyces+cerevisiae+Meyen+ex+E%2EC%2E+Hansen/pm41086805-784-42-41
    Average 96 stars, based on 1 article reviews
    4941 oligonucleotides grna mouse igf1r caccgctatggtggagaggtaacag - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs grna oligonucleotides
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Grna Oligonucleotides, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/BsmBI-v2/bio_rxiv__64898__2026__03__31__715508-202-15-33
    Average 99 stars, based on 1 article reviews
    grna oligonucleotides - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs guide rna oligonucleotides
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Guide Rna Oligonucleotides, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/T4+Polynucleotide+Kinase/pm42108472-145-5-12
    Average 99 stars, based on 1 article reviews
    guide rna oligonucleotides - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    DSMZ health nih ips cell core facility n a ms5 hdll4 stromal cells anindita roy lab n a amo1 cell line dsmz rrid cvcl 1806 oligonucleotides grna
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Health Nih Ips Cell Core Facility N A Ms5 Hdll4 Stromal Cells Anindita Roy Lab N A Amo1 Cell Line Dsmz Rrid Cvcl 1806 Oligonucleotides Grna, supplied by DSMZ, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/AMO-1/pm41734765-267-205-222
    Average 95 stars, based on 1 article reviews
    health nih ips cell core facility n a ms5 hdll4 stromal cells anindita roy lab n a amo1 cell line dsmz rrid cvcl 1806 oligonucleotides grna - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    86
    Eurofins single guide rna sgrna oligos for insertion
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Single Guide Rna Sgrna Oligos For Insertion, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/containing+guide+rna/pmc11741932-640-0-13
    Average 86 stars, based on 1 article reviews
    single guide rna sgrna oligos for insertion - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Macrogen grna template oligos
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Grna Template Oligos, supplied by Macrogen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/grna+oligos+template/bio_rxiv__2025__11__24__690106-173-1-7
    Average 86 stars, based on 1 article reviews
    grna template oligos - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc oligonucleotides grna
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Oligonucleotides Grna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/a+a+caagagaaagcagcgaggct+grna+house+in+n+n+oligonucleotides+risp+software+synthego/pm40803321-1328-226-231
    Average 86 stars, based on 1 article reviews
    oligonucleotides grna - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech insert oligonucleotide grna sequences
    A) Flow cytometry gating strategy for K562 VPR cells transduced with <t>CRISPRa-gRNA</t> and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.
    Insert Oligonucleotide Grna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/grna+insert+oligonucleotide+sequences/pm41015164-73-2-15
    Average 86 stars, based on 1 article reviews
    insert oligonucleotide grna sequences - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    New England Biolabs grna spacer sequence oligos
    a , Assay schematic, where paired gRNAs induce DNA breaks that lead to perfect junctions for nuclease variants that cut at the canonical position between the +1 and −1 nucleotides. Shifts in the cut position lead to retention of additional sequences within the junction, and the frequencies of these retained sequences are used to determine the nick shift frequencies for each nuclease variant. b , Design of <t>gRNA</t> pairs and expected sequences of the junction products at the CXCR4 and EMX1 loci, with the expected retained sequences due to shifts in nick position indicated. c , Rates of the top genomic sequences resulting from editing with different Cas9 variants at the junction for the CXCR4 locus. Only reads with the <t>reference</t> <t>sequence</t> or retained sequences (insertions boxed in red) are depicted. The most frequent allelic sequences above 0.05% of reads are displayed along with sequencing reads and percentages out of all reads. d , DNA nick position frequencies for nuclease variants averaged at the CXCR4 and EMX1 loci. The relative frequencies of retained sequences in the junction products are used to estimate the frequencies of nick shifts of corresponding length. Data were analysed by deep sequencing and represent a single replicate (in c ) or means of n = 6 independent replicates (in d ).
    Grna Spacer Sequence Oligos, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/grna+oligonucleotides/T4+Polynucleotide+Kinase/pmc12571883-190-2-17
    Average 99 stars, based on 1 article reviews
    grna spacer sequence oligos - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    A) Flow cytometry gating strategy for K562 VPR cells transduced with CRISPRa-gRNA and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.

    Journal: bioRxiv

    Article Title: DNA Damage Response Proteins Are Involved in the Formation of Defective HIV-1 Proviruses

    doi: 10.64898/2026.03.31.715508

    Figure Lengend Snippet: A) Flow cytometry gating strategy for K562 VPR cells transduced with CRISPRa-gRNA and LTatC[M]L lentiviral vectors. Example shown for CRISPRa-HLTF technical replicates. B) Single mCherry+/double-positive Cerulean+/mCherry+ (mCherry/Dp) cell ratio for candidate genes in K562-VPR cells transduced with corresponding CRISPRa-gRNA and LTatC[M]L. Data shown relative to non-targeting control gRNA, marked by the dotted line. Each dot represents one technical replicate. C) mCherry/Dp ratio for candidate genes in K562 cells transfected with corresponding siRNA and transduced with LTatC[M]L. From the left: transfection with siRNAs targeting single genes; transfection with combination of siRNAs targeting two genes. Data shown relative to scrambled control siRNA, marked by the dotted line. Each dot represents one technical replicate. All data was statistically tested using mixed-effect logistic regression model, p value <0.1 was considered significant. **** = p <0.001, *** p <0.01, ** p <0.05.

    Article Snippet: The Golden Gate reaction contained 25 ng backbone plasmid, 1 μl of 1:10 diluted annealed gRNA oligonucleotides, 0.5 μl BsmBI-v2, 0.5 μl T4 DNA ligase (Thermo Scientific, EL0011), 1 μl 10 mM ATP (New England Biolabs, P0756S), 1 μl NEB Buffer r3.1 (New England Biolabs), and nuclease-free water to the final reaction volume.

    Techniques: Flow Cytometry, Transduction, Control, Transfection

    a , Assay schematic, where paired gRNAs induce DNA breaks that lead to perfect junctions for nuclease variants that cut at the canonical position between the +1 and −1 nucleotides. Shifts in the cut position lead to retention of additional sequences within the junction, and the frequencies of these retained sequences are used to determine the nick shift frequencies for each nuclease variant. b , Design of gRNA pairs and expected sequences of the junction products at the CXCR4 and EMX1 loci, with the expected retained sequences due to shifts in nick position indicated. c , Rates of the top genomic sequences resulting from editing with different Cas9 variants at the junction for the CXCR4 locus. Only reads with the reference sequence or retained sequences (insertions boxed in red) are depicted. The most frequent allelic sequences above 0.05% of reads are displayed along with sequencing reads and percentages out of all reads. d , DNA nick position frequencies for nuclease variants averaged at the CXCR4 and EMX1 loci. The relative frequencies of retained sequences in the junction products are used to estimate the frequencies of nick shifts of corresponding length. Data were analysed by deep sequencing and represent a single replicate (in c ) or means of n = 6 independent replicates (in d ).

    Journal: Nature

    Article Title: Engineered prime editors with minimal genomic errors

    doi: 10.1038/s41586-025-09537-3

    Figure Lengend Snippet: a , Assay schematic, where paired gRNAs induce DNA breaks that lead to perfect junctions for nuclease variants that cut at the canonical position between the +1 and −1 nucleotides. Shifts in the cut position lead to retention of additional sequences within the junction, and the frequencies of these retained sequences are used to determine the nick shift frequencies for each nuclease variant. b , Design of gRNA pairs and expected sequences of the junction products at the CXCR4 and EMX1 loci, with the expected retained sequences due to shifts in nick position indicated. c , Rates of the top genomic sequences resulting from editing with different Cas9 variants at the junction for the CXCR4 locus. Only reads with the reference sequence or retained sequences (insertions boxed in red) are depicted. The most frequent allelic sequences above 0.05% of reads are displayed along with sequencing reads and percentages out of all reads. d , DNA nick position frequencies for nuclease variants averaged at the CXCR4 and EMX1 loci. The relative frequencies of retained sequences in the junction products are used to estimate the frequencies of nick shifts of corresponding length. Data were analysed by deep sequencing and represent a single replicate (in c ) or means of n = 6 independent replicates (in d ).

    Article Snippet: The nicking gRNA spacer sequence oligos, listed in Supplementary Table , were phosphorylated with T4 polynucleotide kinase (NEB) and cloned into gRNA cloning backbone by Golden Gate cloning with BpiI digestion.

    Techniques: Variant Assay, Genomic Sequencing, Sequencing

    a , Assay schematic for end degradation comparing nuclease variants, where paired gRNAs induce DNA breaks that lead to perfect junctions for non-degraded DNA ends and deletions in the junction products indicate degradation of the DNA ends. The length of each deletion to the non-PAM-side or PAM-side of the junction indicates the extent of degradation, and the frequencies of these deletions indicate the frequency of degradation. b , Design of gRNA pairs and expected sequences of the junction products at the EMX1 and CXCR4 loci, with the direction of degradation-associated deletions indicated. c , Rates of the top genomic sequences resulting from editing with different Cas9 variants at the junction for the EMX1 locus. Only reads with the reference sequence or deletions are depicted. The most frequent allelic sequences above 0.05% of reads are displayed along with sequencing reads and percentages out of all reads. d , Assay schematic for end degradation comparing prime editor variants, where a paired pegRNA and ngRNA induce DNA nicks that lead to large deletions between homologies in the flaps flanking the nicks for non-degraded ends but cannot produce deletions if the nicked end flaps are degraded. The pegRNA can also install a larger edit that is used as an activity marker for the prime editor, and degradation is quantitated as the ratio of the activity marker edit to the flap homology deletion. e , Design of the pegRNA and ngRNA pair at the AAVS1 locus, with the extensive GC-rich homologies indicated. f , Deletion frequencies by position within the targeted locus comparing several prime editor variants, indicating dominant deletions between homologous sequences flanking the nicks. Data were analysed by deep sequencing and represent a single replicate (in c ) or means of n = 3 independent replicates (in f ).

    Journal: Nature

    Article Title: Engineered prime editors with minimal genomic errors

    doi: 10.1038/s41586-025-09537-3

    Figure Lengend Snippet: a , Assay schematic for end degradation comparing nuclease variants, where paired gRNAs induce DNA breaks that lead to perfect junctions for non-degraded DNA ends and deletions in the junction products indicate degradation of the DNA ends. The length of each deletion to the non-PAM-side or PAM-side of the junction indicates the extent of degradation, and the frequencies of these deletions indicate the frequency of degradation. b , Design of gRNA pairs and expected sequences of the junction products at the EMX1 and CXCR4 loci, with the direction of degradation-associated deletions indicated. c , Rates of the top genomic sequences resulting from editing with different Cas9 variants at the junction for the EMX1 locus. Only reads with the reference sequence or deletions are depicted. The most frequent allelic sequences above 0.05% of reads are displayed along with sequencing reads and percentages out of all reads. d , Assay schematic for end degradation comparing prime editor variants, where a paired pegRNA and ngRNA induce DNA nicks that lead to large deletions between homologies in the flaps flanking the nicks for non-degraded ends but cannot produce deletions if the nicked end flaps are degraded. The pegRNA can also install a larger edit that is used as an activity marker for the prime editor, and degradation is quantitated as the ratio of the activity marker edit to the flap homology deletion. e , Design of the pegRNA and ngRNA pair at the AAVS1 locus, with the extensive GC-rich homologies indicated. f , Deletion frequencies by position within the targeted locus comparing several prime editor variants, indicating dominant deletions between homologous sequences flanking the nicks. Data were analysed by deep sequencing and represent a single replicate (in c ) or means of n = 3 independent replicates (in f ).

    Article Snippet: The nicking gRNA spacer sequence oligos, listed in Supplementary Table , were phosphorylated with T4 polynucleotide kinase (NEB) and cloned into gRNA cloning backbone by Golden Gate cloning with BpiI digestion.

    Techniques: Genomic Sequencing, Sequencing, Activity Assay, Marker